ID: 1168095161_1168095174

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1168095161 1168095174
Species Human (GRCh38) Human (GRCh38)
Location 19:54110256-54110278 19:54110291-54110313
Sequence CCCATCCCTCCGGCTCCCCTCTC TCCTGAGTGCCCTCCAGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 762} {0: 1, 1: 0, 2: 0, 3: 16, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!