ID: 1168095164_1168095173

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1168095164 1168095173
Species Human (GRCh38) Human (GRCh38)
Location 19:54110262-54110284 19:54110290-54110312
Sequence CCTCCGGCTCCCCTCTCACCATG GTCCTGAGTGCCCTCCAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 26, 4: 316} {0: 1, 1: 0, 2: 0, 3: 19, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!