ID: 1168099724_1168099729

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1168099724 1168099729
Species Human (GRCh38) Human (GRCh38)
Location 19:54134567-54134589 19:54134616-54134638
Sequence CCTTGAGTGGCTGAACTACCCCA CAATGTTATCCCTGACCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95} {0: 1, 1: 0, 2: 0, 3: 8, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!