ID: 1168110548_1168110557

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1168110548 1168110557
Species Human (GRCh38) Human (GRCh38)
Location 19:54189425-54189447 19:54189439-54189461
Sequence CCCCCGCGCCGCCTGCTCCTTCT GCTCCTTCTGGGCGCCCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 428} {0: 1, 1: 1, 2: 0, 3: 13, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!