ID: 1168110550_1168110560

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1168110550 1168110560
Species Human (GRCh38) Human (GRCh38)
Location 19:54189427-54189449 19:54189453-54189475
Sequence CCCGCGCCGCCTGCTCCTTCTGG CCCGCCGGGCTGCGCAGATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 388} {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!