ID: 1168110554_1168110565

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1168110554 1168110565
Species Human (GRCh38) Human (GRCh38)
Location 19:54189433-54189455 19:54189459-54189481
Sequence CCGCCTGCTCCTTCTGGGCGCCC GGGCTGCGCAGATCAGGCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 419} {0: 1, 1: 0, 2: 1, 3: 10, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!