ID: 1168110561_1168110575

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1168110561 1168110575
Species Human (GRCh38) Human (GRCh38)
Location 19:54189454-54189476 19:54189492-54189514
Sequence CCGCCGGGCTGCGCAGATCAGGC GGTCAGGGCCCCGGGCGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 89} {0: 1, 1: 0, 2: 1, 3: 51, 4: 528}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!