ID: 1168112463_1168112467

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1168112463 1168112467
Species Human (GRCh38) Human (GRCh38)
Location 19:54201229-54201251 19:54201260-54201282
Sequence CCCGCGGAGACCCTTCGAGAAAT GACCAAGAGCTGAAGCTGATCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 4, 4: 36} {0: 2, 1: 0, 2: 3, 3: 17, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!