ID: 1168115317_1168115320

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1168115317 1168115320
Species Human (GRCh38) Human (GRCh38)
Location 19:54219021-54219043 19:54219040-54219062
Sequence CCTGGAACCGGTTTTCTAAACTG ACTGACACCCCTGTGTGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 102} {0: 1, 1: 0, 2: 1, 3: 12, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!