ID: 1168148320_1168148331

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1168148320 1168148331
Species Human (GRCh38) Human (GRCh38)
Location 19:54431502-54431524 19:54431539-54431561
Sequence CCTCTCTCCGTCCTCCTGCCTCT GGCTGCCGCTTAGTGAGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 160, 4: 1768} {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!