ID: 1168148323_1168148331

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1168148323 1168148331
Species Human (GRCh38) Human (GRCh38)
Location 19:54431516-54431538 19:54431539-54431561
Sequence CCTGCCTCTCCCTCCCTCCTAGA GGCTGCCGCTTAGTGAGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 108, 4: 1367} {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!