ID: 1168152379_1168152393

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1168152379 1168152393
Species Human (GRCh38) Human (GRCh38)
Location 19:54456027-54456049 19:54456068-54456090
Sequence CCTTCACCCTCCTAGAGGGGCAG GGGGTGCCCCGTCCCAGCGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 218} {0: 1, 1: 0, 2: 1, 3: 9, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!