ID: 1168153483_1168153488

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1168153483 1168153488
Species Human (GRCh38) Human (GRCh38)
Location 19:54461066-54461088 19:54461107-54461129
Sequence CCGTTTTCCCACCGGGGAGTCTG TTTTTATTTTTTGCCTCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120} {0: 1, 1: 0, 2: 23, 3: 1032, 4: 7552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!