ID: 1168158564_1168158579

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1168158564 1168158579
Species Human (GRCh38) Human (GRCh38)
Location 19:54492798-54492820 19:54492848-54492870
Sequence CCATGCTTTCTTCCTGGACTTTC AGGGAATGAGGGATTGGGGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 8, 3: 79, 4: 1030} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!