ID: 1168169003_1168169014

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1168169003 1168169014
Species Human (GRCh38) Human (GRCh38)
Location 19:54574133-54574155 19:54574161-54574183
Sequence CCAGGTCCCTCCTCCTCACTAGG GGGGCCACCCCCGTGCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 7, 3: 38, 4: 332} {0: 2, 1: 2, 2: 0, 3: 21, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!