ID: 1168202666_1168202680

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1168202666 1168202680
Species Human (GRCh38) Human (GRCh38)
Location 19:54827880-54827902 19:54827923-54827945
Sequence CCCTCACCCAAATCCCCCATCTC GTGGAAATACAGATAGATCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!