ID: 1168210844_1168210852

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1168210844 1168210852
Species Human (GRCh38) Human (GRCh38)
Location 19:54888918-54888940 19:54888954-54888976
Sequence CCTGGCCGGGCGTGGTGGCGTGA GCTACTCAGGAGGCTGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 91, 4: 1108} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!