ID: 1168217370_1168217376

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1168217370 1168217376
Species Human (GRCh38) Human (GRCh38)
Location 19:54936199-54936221 19:54936213-54936235
Sequence CCCCCAGCAACACGGTGCAGTGG GTGCAGTGGACTCCAGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 111} {0: 1, 1: 0, 2: 1, 3: 10, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!