ID: 1168217878_1168217889

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1168217878 1168217889
Species Human (GRCh38) Human (GRCh38)
Location 19:54939680-54939702 19:54939733-54939755
Sequence CCCTTCTCCATCTGCAGCTTCAG GGCCGAGCCCAGCTGGAACAGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 3, 3: 58, 4: 549} {0: 2, 1: 0, 2: 0, 3: 15, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!