ID: 1168241371_1168241382

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1168241371 1168241382
Species Human (GRCh38) Human (GRCh38)
Location 19:55090812-55090834 19:55090849-55090871
Sequence CCGGCACCCACCCAAGTGGCCCA GACACGCACGGCCCCCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 230} {0: 1, 1: 0, 2: 0, 3: 10, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!