ID: 1168241380_1168241382

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1168241380 1168241382
Species Human (GRCh38) Human (GRCh38)
Location 19:55090832-55090854 19:55090849-55090871
Sequence CCAGTGGTTTGGTCATGGACACG GACACGCACGGCCCCCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 78} {0: 1, 1: 0, 2: 0, 3: 10, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!