ID: 1168242731_1168242749

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1168242731 1168242749
Species Human (GRCh38) Human (GRCh38)
Location 19:55095509-55095531 19:55095559-55095581
Sequence CCCTCCGCTGTCCGCCTTTCAGG CTTCAGGAGGCCAAAGCGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 98} {0: 1, 1: 0, 2: 18, 3: 264, 4: 3485}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!