ID: 1168246642_1168246649

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1168246642 1168246649
Species Human (GRCh38) Human (GRCh38)
Location 19:55115950-55115972 19:55115980-55116002
Sequence CCCTGGAAGATGCCATGACAGGG AGAGCTAGCACAGACTAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 185} {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
7 19:55115950-55115972 CCCTGGAAGATGCCATGACAGGG - 19:55115980-55116002 AGAGCTAGCACAGACTAGAGAGG +