ID: 1168246642_1168246653

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1168246642 1168246653
Species Human (GRCh38) Human (GRCh38)
Location 19:55115950-55115972 19:55115988-55116010
Sequence CCCTGGAAGATGCCATGACAGGG CACAGACTAGAGAGGTAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 185} {0: 1, 1: 0, 2: 1, 3: 20, 4: 218}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
15 19:55115950-55115972 CCCTGGAAGATGCCATGACAGGG - 19:55115988-55116010 CACAGACTAGAGAGGTAAGGGGG +