ID: 1168252109_1168252116

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1168252109 1168252116
Species Human (GRCh38) Human (GRCh38)
Location 19:55147151-55147173 19:55147176-55147198
Sequence CCGACATCCTGGTGCGGCCTAAG CCAGAGAGAAGAGGCCCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63} {0: 1, 1: 0, 2: 3, 3: 39, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!