ID: 1168257416_1168257424

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1168257416 1168257424
Species Human (GRCh38) Human (GRCh38)
Location 19:55174301-55174323 19:55174337-55174359
Sequence CCCGCTTAGAGCAGATAGGACAC TAAGGAGTCTCTTCCTGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 81} {0: 1, 1: 0, 2: 1, 3: 19, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!