ID: 1168267104_1168267116

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1168267104 1168267116
Species Human (GRCh38) Human (GRCh38)
Location 19:55229076-55229098 19:55229110-55229132
Sequence CCCATCATGGGAAGCGGGAGAGG AGGAGTGCCCCTGGAGGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 126} {0: 1, 1: 0, 2: 0, 3: 17, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!