ID: 1168267410_1168267423

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1168267410 1168267423
Species Human (GRCh38) Human (GRCh38)
Location 19:55230387-55230409 19:55230422-55230444
Sequence CCTCCTGGGGGTCCAGAGGAGAG TCAGGGTGATGAGGGCAATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 299} {0: 1, 1: 0, 2: 0, 3: 24, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!