ID: 1168267416_1168267422

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1168267416 1168267422
Species Human (GRCh38) Human (GRCh38)
Location 19:55230399-55230421 19:55230421-55230443
Sequence CCAGAGGAGAGAATGTGGGGGTG GTCAGGGTGATGAGGGCAATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 37, 4: 265} {0: 1, 1: 0, 2: 0, 3: 21, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!