ID: 1168288350_1168288357

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1168288350 1168288357
Species Human (GRCh38) Human (GRCh38)
Location 19:55345469-55345491 19:55345494-55345516
Sequence CCAGTAGGGGTCTCGGGGAGGCG GAGGATGAGGATGCGGGAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 12, 3: 198, 4: 1653}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!