ID: 1168290090_1168290101

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1168290090 1168290101
Species Human (GRCh38) Human (GRCh38)
Location 19:55353352-55353374 19:55353395-55353417
Sequence CCCTGGGCTGGCTCGTAGCTGTC TGGAATGGAGAGGGAGAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 100} {0: 1, 1: 2, 2: 17, 3: 164, 4: 1594}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!