ID: 1168291475_1168291493

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1168291475 1168291493
Species Human (GRCh38) Human (GRCh38)
Location 19:55359684-55359706 19:55359725-55359747
Sequence CCCGGCCCCTGGTGGGAGCCCAT GCCCCTGGGGATGGAAGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 283} {0: 1, 1: 1, 2: 4, 3: 44, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!