ID: 1168292370_1168292390

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1168292370 1168292390
Species Human (GRCh38) Human (GRCh38)
Location 19:55362833-55362855 19:55362883-55362905
Sequence CCGTTCCCTCTCAAGATCCCCCA CCCTCTCAGCCCCGGGGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 318} {0: 1, 1: 0, 2: 3, 3: 27, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!