ID: 1168296394_1168296406

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1168296394 1168296406
Species Human (GRCh38) Human (GRCh38)
Location 19:55379104-55379126 19:55379136-55379158
Sequence CCAGGGCTCCTGGTCTCCCCAGG GCCTCACCTCAGGTGTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 575} {0: 1, 1: 0, 2: 0, 3: 15, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!