ID: 1168310060_1168310071

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1168310060 1168310071
Species Human (GRCh38) Human (GRCh38)
Location 19:55455722-55455744 19:55455764-55455786
Sequence CCATGCTGAAGCAGGTCTTGGCC TCCCCAGCTCGGGCACCGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 143} {0: 1, 1: 0, 2: 1, 3: 12, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!