ID: 1168317187_1168317208

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1168317187 1168317208
Species Human (GRCh38) Human (GRCh38)
Location 19:55489465-55489487 19:55489514-55489536
Sequence CCGTGGCCTGCCGGCAGCTGGGC AGGCGCCTTCTTCGGGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 388} {0: 1, 1: 0, 2: 2, 3: 10, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!