ID: 1168331786_1168331796

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1168331786 1168331796
Species Human (GRCh38) Human (GRCh38)
Location 19:55574529-55574551 19:55574576-55574598
Sequence CCTCTCAGAGCTTCAGTTTGTTG CCCTTTCTTGCTGTTTCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 118, 4: 956} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!