ID: 1168340655_1168340659

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1168340655 1168340659
Species Human (GRCh38) Human (GRCh38)
Location 19:55621442-55621464 19:55621469-55621491
Sequence CCAAGAGACAGTCGGGGAAGTGA CAGCCCGTGGGCCTTGCCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 157} {0: 1, 1: 0, 2: 1, 3: 11, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!