ID: 1168341231_1168341248

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1168341231 1168341248
Species Human (GRCh38) Human (GRCh38)
Location 19:55624293-55624315 19:55624342-55624364
Sequence CCCGCCCACCATGACATAGTCTC CACAAGAAGCCCCACCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 127} {0: 1, 1: 0, 2: 2, 3: 36, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!