ID: 1168341240_1168341248

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1168341240 1168341248
Species Human (GRCh38) Human (GRCh38)
Location 19:55624324-55624346 19:55624342-55624364
Sequence CCCCGCCCCTCGCGAAACCACAA CACAAGAAGCCCCACCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 44} {0: 1, 1: 0, 2: 2, 3: 36, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!