ID: 1168360788_1168360791

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1168360788 1168360791
Species Human (GRCh38) Human (GRCh38)
Location 19:55738173-55738195 19:55738201-55738223
Sequence CCTGCTTTCCTGGGTAATGTTTG CAGCTTTGCTACATCTTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 1810} {0: 2, 1: 0, 2: 2, 3: 24, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!