|
Left Crispr |
Right Crispr |
| Crispr ID |
1168360788 |
1168360792 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:55738173-55738195
|
19:55738204-55738226
|
| Sequence |
CCTGCTTTCCTGGGTAATGTTTG |
CTTTGCTACATCTTCTTTGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 2, 3: 50, 4: 1810} |
{0: 1, 1: 0, 2: 3, 3: 22, 4: 275} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|