ID: 1168360788_1168360793

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1168360788 1168360793
Species Human (GRCh38) Human (GRCh38)
Location 19:55738173-55738195 19:55738225-55738247
Sequence CCTGCTTTCCTGGGTAATGTTTG GGCCTTCTTCAGCTCAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 1810} {0: 1, 1: 0, 2: 1, 3: 17, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!