ID: 1168426574_1168426576

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1168426574 1168426576
Species Human (GRCh38) Human (GRCh38)
Location 19:56244106-56244128 19:56244121-56244143
Sequence CCGCCACAGTCTGTGGCTTCCCC GCTTCCCCAGAAACTCAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 298} {0: 1, 1: 1, 2: 1, 3: 10, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!