ID: 1168435076_1168435082

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1168435076 1168435082
Species Human (GRCh38) Human (GRCh38)
Location 19:56310229-56310251 19:56310251-56310273
Sequence CCCTGGACTGCCTGTGTGGAGGG GTAATGAACTGGGTCCTTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 244} {0: 1, 1: 0, 2: 1, 3: 10, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!