ID: 1168435076_1168435085

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1168435076 1168435085
Species Human (GRCh38) Human (GRCh38)
Location 19:56310229-56310251 19:56310264-56310286
Sequence CCCTGGACTGCCTGTGTGGAGGG TCCTTTAAGGAATGGCACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 244} {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!