ID: 1168451006_1168451010

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1168451006 1168451010
Species Human (GRCh38) Human (GRCh38)
Location 19:56466542-56466564 19:56466589-56466611
Sequence CCCTGGTTACCAGGCCTCTGGTT CTGTCTTAAAGTGAGTAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 8, 3: 14, 4: 193} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!