ID: 1168468975_1168468978

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1168468975 1168468978
Species Human (GRCh38) Human (GRCh38)
Location 19:56625645-56625667 19:56625675-56625697
Sequence CCCTGCTCACTCTGCTTCAGCCA CTTTCGTTCAGTCCCAGCGCTGG
Strand - +
Off-target summary {0: 2, 1: 21, 2: 105, 3: 303, 4: 875} {0: 1, 1: 0, 2: 0, 3: 7, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!