|
Left Crispr |
Right Crispr |
| Crispr ID |
1168468975 |
1168468981 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
19:56625645-56625667
|
19:56625697-56625719
|
| Sequence |
CCCTGCTCACTCTGCTTCAGCCA |
GCCCAGCCCACTCCCACCGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 21, 2: 105, 3: 303, 4: 875} |
{0: 1, 1: 1, 2: 5, 3: 47, 4: 419} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|