ID: 1168471631_1168471638

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1168471631 1168471638
Species Human (GRCh38) Human (GRCh38)
Location 19:56644879-56644901 19:56644919-56644941
Sequence CCTTCCAATATCTGAGACTACAG TGGCTAATTTTTAAACTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 12, 3: 202, 4: 1630} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!